agcactgtgttggcgtacag qpcr cell lines v6 5 mouse embryonic stem cells novus biologicals rrid cvcl c865 dot1l ko mescs  (Novus Biologicals)

Journal: Nature Communications

Article Title: Addressing the specific roles of histone modifications in transcriptional repression

doi: 10.1038/s41467-025-66426-z

Figure Lengend Snippet: a Schematic illustration of PRC2 composition. SUZ12 acts as a scaffold for the complex, containing a C-terminal VEFS domain binding to core-subunits EZH1/2 and EED and an N-terminal region (S12 N ) interacting with the PRC2 non-core subunits. The VEFS domain of SUZ12 is required for catalytic activity, while chromatin binding depends on the S12 N domain and the associated non-core subunits. b Mean SUZ12 ChIP-seq signals (RPKM) for WT mESCs and Suz12 KO mESCs with ectopic expression of S12 N or WT SUZ12 within a 40 kb window centered on 7732 H3K27me3 positive promoter peaks identified in WT mESCs ( n = 1). c Representative western blot probing for global H3K27me3 and the expression of fusion constructs using an anti-SUZ12 antibody ( n = 3). d Pearson correlation for the expression phenotypes of the indicated cell lines in three independent biological replicates. e Schematic drawing of the experimental strategy to recruit H3K9me3 and H3K36me3 to PRC2 target genes, using the S12 N -PRC2 as a recruiter. f Mean SUZ12 ChIP-seq signals (RPKM) ( n = 1) of extracts prepared from Suz12 KO mESCs with ectopic expression of fusion constructs within a 40 kb window centered on 7732 H3K27me3 positive promoter peaks identified in WT mESCs.

Article Snippet: For KDM4 inhibitor experiments, Suz12 KO mESCs expressing S12 N :SUV2 were treated with 50 nM or 100 nM of the KDM4C inhibitor QC6352 (MedChemExpress) for 96 h with media renewal every 24 h. An overview of cell lines can be found in Supplementary Table .

Techniques: Binding Assay, Activity Assay, ChIP-sequencing, Expressing, Western Blot, Construct

Journal: Nature Communications

Article Title: Addressing the specific roles of histone modifications in transcriptional repression

doi: 10.1038/s41467-025-66426-z

Figure Lengend Snippet: a Schematic drawing of the domain architecture of the fusions S12 N :SD2 and S12 N :SD2* with indications of boundaries (amino acid numbers referring to the sequence in WT SUZ12 and SETD2). Asterisk indicates a point mutation introduced to generate catalytic inactive S12 N :SD2*. b – e CUT&RUN tracks showing H3K27me3, H3K4me3, and H3K36me3 signals (RPKM) from the indicated cell lines within a representative genomic region that includes the HoxA cluster ( b ), PRC2 target genes Bmi1 , Spag6 , and Carlr ( c ), PRC2 target genes Fgf3 and Fgf15 and the endogenously H3K36me3 positive Fgf4 gene ( d ), and PRC2 target gene Ntng2 and the endogenously H3K36me3 positive Setx gene ( e ). The tracks are representative from one biological replicate, performed in biological duplicates ( n = 2). CGI annotations (red) are shown below the track. f Mean H3K36me3 CUT&RUN signals (RPKM) in indicated cell lines within a 40 kb window centered on 7732 H3K27me3 positive promoter peaks identified in WT mESCs. g Plot of H3K36me3 CUT&RUN signals (RPM) enrichment within peak boundaries of all H3K27me3 peaks identified in WT mESCs (promoter and non-promoter; n = 22307) for the indicated cell lines quantified using BedTools Multicov. Smoothed lines represent generalized additive model (GAM) fits of mean H3K36me3 signal intensity (RPM) from two independent biological replicates ( n = 2), as a function of H3K27me3 CUT&RUN signal intensity (RPM) in WT mESCs ( n = 1); shaded ribbons show the 95% confidence interval of the fitted mean (not variability between biological replicates).

Article Snippet: For KDM4 inhibitor experiments, Suz12 KO mESCs expressing S12 N :SUV2 were treated with 50 nM or 100 nM of the KDM4C inhibitor QC6352 (MedChemExpress) for 96 h with media renewal every 24 h. An overview of cell lines can be found in Supplementary Table .

Techniques: Sequencing, Mutagenesis

Journal: Nature Communications

Article Title: Addressing the specific roles of histone modifications in transcriptional repression

doi: 10.1038/s41467-025-66426-z

Figure Lengend Snippet: a Cluster heatmap (k-means, 4) of RNA-seq data analyzed with Deseq2 for differential expression (FDR < 0.05). Heatmap shows differentially expressed PRC2 target genes identified by H3K27me3 positive promoters in WT mESCs ( n = 4986) in the indicated cell lines based on three independent biological replicates. b MA plots showing mean changes in gene expression from Deseq2 analysis based on three independent biological replicates ( n = 3). Indicated with red dots are significantly upregulated genes in Suz12 KO mESCs filtered with log2 expression foldchange > 1 and FDR < 0.05. The mean expression of the upregulated genes in Suz12 KO mESCs are traced in the indicated cell lines. c Bar plot showing the fraction of the 1326 upregulated PRC2 target genes in Suz12 KO mESCs that are fully or partially rescued in the indicated cell lines (see methods for filtering criteria). Statistical significance was calculated using Fisher’s exact test, two-tailed (* p < 0.05; ** p < 0.01; *** p < 0.001, **** p < 0.0001). Source data are provided as a Source Data file. d Bar plot showing the percentage of beating clusters identified on day 10 after induction of embryoid body differentiation in the indicated cell lines. The plot is representative of at least three independent experiments. e Mean H3K4me3 CUT&RUN signals (RPKM) ( n = 2) in indicated cell lines within a 40 Kb window centered on 7732 H3K27me3 positive promoter peaks identified in WT mESCs. f Custom annotation based DMR methylation (%, see methods) at CpG islands for indicated cell lines ( n = 3). The horizontal lines mark the median; the boxes mark the interquartile range (IQR) and whiskers extend up to 1.5 times the IQR; individual data points beyond this range are plotted. Statistical significance was calculated for the means using an unpaired two-sample t test, two-tailed (* p < 0.05; ** p < 0.01; *** p < 0.001, **** p < 0.0001). Source data are provided as a Source Data file.

Article Snippet: For KDM4 inhibitor experiments, Suz12 KO mESCs expressing S12 N :SUV2 were treated with 50 nM or 100 nM of the KDM4C inhibitor QC6352 (MedChemExpress) for 96 h with media renewal every 24 h. An overview of cell lines can be found in Supplementary Table .

Techniques: RNA Sequencing, Quantitative Proteomics, Gene Expression, Expressing, Two Tailed Test, Methylation

Journal: Nature Communications

Article Title: Addressing the specific roles of histone modifications in transcriptional repression

doi: 10.1038/s41467-025-66426-z

Figure Lengend Snippet: a Schematic drawing of the domain architecture of S12 N :SUV2 and S12 N :SUV2* with indications of boundaries (amino acid numbers referring to the sequence in WT SUZ12 and SUV39H2). Asterisks indicate point mutations introduced to generate the methyltransferase dead S12 N :SUV2*. b – e CUT&RUN track showing H3K27me3, H3K4me3, and H3K9me3 signals (RPKM and peak-normalization) from indicated cell lines within a representative genomic region that includes the PRC2 target genes Prdm12 , Fibcd1, Lamc3 , and Aif1l ( b ), PRC2 target gene Ntng2 with adjacent endogenous H3K9me3 peak ( c ), the PRC2 target gene Thbs2 with adjacent endogenous H3K9me3 peaks ( d ) and the Hox A cluster ( e ). Representative tracks from one biological replicate, performed in biological duplicates ( n = 2). CGI annotations (red) are shown below the tracks. f Mean H3K9me3 CUT&RUN signals (peak-normalization) in indicated cell lines within a 40 Kb window centered on 7732 H3K27me3 positive promoter peaks identified in WT mESCs, scale on the right side. WT mESC H3K4me3 CUT&RUN signal (RPKM) is included for reference with the scale on the left. g Plot of H3K9me3 CUT&RUN signals (RPM) enrichment within peak boundaries of all H3K27me3 peaks identified in WT mESCs (promoter and non-promoter; n = 22307) for the indicated cell lines, quantified using BedTools Multicov. Smoothed lines represent generalized additive model (GAM) fits of mean H3K9me3 signal intensity (RPM) from two independent biological replicates ( n = 2), as a function of H3K27me3 CUT&RUN signal intensity (RPM) in WT mESCs ( n = 1); shaded ribbons show the 95% confidence interval of the fitted mean (not variability between biological replicates).

Article Snippet: For KDM4 inhibitor experiments, Suz12 KO mESCs expressing S12 N :SUV2 were treated with 50 nM or 100 nM of the KDM4C inhibitor QC6352 (MedChemExpress) for 96 h with media renewal every 24 h. An overview of cell lines can be found in Supplementary Table .

Techniques: Sequencing

Journal: Nature Communications

Article Title: Addressing the specific roles of histone modifications in transcriptional repression

doi: 10.1038/s41467-025-66426-z

Figure Lengend Snippet: a Cluster heatmap (k-means, 4) of RNA-seq data analyzed with Deseq2 for differential expression (FDR < 0.05) for the indicated cell lines. Heatmap shows z-score normalized counts of differentially expressed PRC2 target genes identified by H3K27me3 positive promoters in WT mESCs ( n = 4986). Based on three independent biological replicates ( n = 3). b MA plots showing mean changes in gene expression from Deseq2 analysis based on three independent biological replicates ( n = 3). Indicated with red dots are significantly upregulated genes in Suz12 KO mESCs filtered with log2 expression fold change> 1 and FDR < 0.05. The mean expression of the upregulated genes in Suz12 KO mESCs are traced in the indicated cell lines. c Bar plot showing the fraction of the 1326 upregulated PRC2 target genes in Suz12 KO mESCs that are fully or partially rescued in the indicated cell lines (see methods for filtering criteria). Statistical significance was calculated using Fisher’s exact test, two-tailed (* p < 0.05; ** p < 0.01; *** p < 0.001, **** p < 0.0001). Source data are provided as a Source Data file. d Bar plot showing the percentage of beating cluster identified on day 10 after induction of embryoid body differentiation in the indicated cell lines. The plot is representative of at least three independent experiments. e Mean H3K4me3 CUT&RUN signals (RPKM) ( n = 2) in indicated cell lines within a 40 Kb window centered on 7732 H3K27me3 positive promoter peaks identified in WT mESCs. f Mean H3K4me3 CUT&RUN signals (RPKM) within 40 Kb window centered on PRC2 target promoters for the H3K9me3-rescued versus non-rescued genes in Suz12 KO mESCs expressing S12 N :SUV2. g Mean H3K9me3 CUT&RUN signal (peak-normalized) within 40 Kb window centered on PRC2 target promoters for the H3K9me3-rescued versus non-rescued genes in Suz12 KO mESCs expressing S12 N :SUV2 ( n = 2). h Heatmaps of sequence depth normalized H3K4me3 CUT&RUN data (blue), SUZ12 ChIP-seq data (S12 N fusion proteins) (red), and peak-normalized H3K9me3 CUT&RUN data (black) at PRC2 target promoters in RBBP5-FKBP12 F36V + Suz12 KO mESCs expressing S12 N :SUV2 treated with dTAG-13 or DMSO for 24hrs. Top: Average plots of the mean signal for the region displayed in heatmaps. i Bar plot of relative gene rescue (%) in RBBP5-FKBP12 F36V + Suz12 KO mESCs expressing S12 N :SUV2 treated with dTAG-13 for 24 h with DMSO treatment for 24 hrs as reference ( n = 3).

Article Snippet: For KDM4 inhibitor experiments, Suz12 KO mESCs expressing S12 N :SUV2 were treated with 50 nM or 100 nM of the KDM4C inhibitor QC6352 (MedChemExpress) for 96 h with media renewal every 24 h. An overview of cell lines can be found in Supplementary Table .

Techniques: RNA Sequencing, Quantitative Proteomics, Gene Expression, Expressing, Two Tailed Test, Sequencing, ChIP-sequencing

Journal: PLoS Biology

Article Title: Alternative splicing of METTL3 explains apparently METTL3-independent m 6 A modifications in mRNA

doi: 10.1371/journal.pbio.3001683

Figure Lengend Snippet: ( A ) Mettl3 KO mESCs from two groups have different m 6 A levels. To reconfirm the m 6 A levels using quantitative methods, we performed mass spectrometry to estimate the m 6 A in mRNA. Exon2 Mettl3 KO mESCs show persistence of 40.2% (exon2 Mettl3 KO mESC-a) and 55.6% (exon2 Mettl3 KO mESC-b) m 6 A, respectively, while exon4 Mettl3 KO mESCs show 1.45% m 6 A compared to WT. This confirms that exon4 Mettl3 KO mESCs have near-complete loss of m 6 A, but not the exon2 Mettl3 KO mESCs. Error bars indicate standard error ( n = 3 for all, except n = 2 for exon2 Mettl3 KO mESC-b). * = p -value < 0.5, ** = p -value < 0.01, *** = p -value < 0.005, n.s. = not significant. Underlying data can be found in . ( B ) Exon2 Mettl3 KO mESCs exhibit new anti-METTL3-immunoreactive bands. To investigate the effectiveness of the Mettl3 knockout, we measured the loss of METTL3 via WB. Full-length METTL3 (75 kDa, arrowhead) was lost in both KO cell lines, but new bands, which were reactive to the anti-METTL3-antibody, appeared at approximately 50 kDa in exon2 Mettl3 KO mESC-a and approximately 55 kDa in exon2 Mettl3 KO mESC-b (arrowheads). This indicates the possibility that a novel smaller METTL3 protein was expressed in the exon2 Mettl3 KO mESCs. In contrast, exon4 Mettl3 KO mESCs have no proteins reactive to anti-METTL3-antibodies. 30 μg per lane. ( C ) 5′ RACE reveals the expression of shorter Mettl3 mRNAs in the Mettl3 KO mESCs. We used 5′ RACE to identify novel Mettl3 mRNAs in the Mettl3 KO mESCs. The full-length RACE product (approximately 1,500 bp) was lost in the Mettl3 KO cells, but novel products at approximately 1,000 bp and approximately 700 bp were found in exon2 Mettl3 KO mESC-a and at approximately 1,500 bp and approximately 1,300 bp in exon2 Mettl3 KO mESC-b. These shorter mRNAs may encode the smaller METTL3 proteins seen in the KO cells. ( D ) Sequencing of 5′ RACE products show Mettl3 mRNAs with exon skipping or alternative transcription-start sites. We sequenced the 5′ RACE products to characterize the Mettl3 mRNA transcripts that are expressed by the exon2 Mettl3 KO mESCs. All Mettl3 mRNAs expressed in the KO cells skipped the guide RNA deletion region by exon skipping, or by using alternative transcription-start sites downstream of the deletion. The longest ORFs that are in-frame with the WT Mettl3 mRNAs are shown as solid lines below each mRNA. The encoded protein is also represented, with the domains required for METTL3 activity shown. m 6 A, N 6 -methyladenosine; mESC, mouse embryonic stem cell; NLS, nuclear localization signal; ORF, open reading frame; pAb, polyclonal antibody; RACE, rapid amplification of cDNA ends; WB, western blot; WT, wild-type; ZFD, zinc finger domain.

Article Snippet: Polysomes were isolated from exon2 Mettl3 KO mESCs as follows: cells were lysed in lysis buffer (20 mM Tris-HCL (pH 7.4), 100 mM KCl, 5 mM MgCl 2, 1% Triton-X 100, 100 μg/ml cycloheximide, 2 mM DTT, 1× Halt Protease Inhibitor (Thermo Scientific #78430)) by passing through a 25 G 1 1⁄2 syringe 10 times.

Techniques: Mass Spectrometry, Knock-Out, Expressing, Sequencing, Activity Assay, Rapid Amplification of cDNA Ends, Western Blot

Journal: PLoS Biology

Article Title: Alternative splicing of METTL3 explains apparently METTL3-independent m 6 A modifications in mRNA

doi: 10.1371/journal.pbio.3001683

Figure Lengend Snippet: ( A ) The predicted domain structure of proteins encoded by the altered METTL3 ORFs expressed in exon2 Mettl3 KO mESCs suggests they may be functional. The domains that are known to be necessary for m 6 A formation by METTL3 include the WTAP-binding domain , ZFD [ , ], and methyltransferase domain [ , ]. To determine if the METTL3 ORFs from exon2 Mettl3 KO mESCs encode functional METTL3 proteins, we predicted the domain structure of the METTL3 protein isoforms from their ORFs. While all the predicted proteins have the methyltransferase domain, only METTL3-a.ii and METTL3-b.ii have all the known critical domains for m 6 A-writing. ( B ) WB of transfected FLAG-tagged METTL3 isoform ORFs. To determine if the METTL3 ORFs we found in the knockout cells can synthesize m 6 A, we expressed the METTL3 ORFs in exon4 Mettl3 KO mESCs that exhibit no METTL3 protein and essentially no baseline m 6 A signal. After 48 h, the alternatively spliced METTL3 proteins can be detected by immunoblotting with an anti-METTL3 antibody. FLAG-METTL3-a.ii (50 kDa, red arrowhead) and FLAG-METTL3-b.ii (55 kDa, blue arrowhead) have similar sizes to the anti-METTL3-antibody-reactive protein seen in exon2 Mettl3 KO mESC-a (red arrowhead) and exon2 Mettl3 KO mESC-b (blue arrowhead), respectively. 30 μg per lane. ( C ) Isoforms of METTL3 proteins can write m 6 A. After 48 h of transfection, RNA from each sample was processed, and m 6 A was measured using mass spectrometry. Expression of full-length WT METTL3 was able to rescue 19.7% of the m 6 A. METTL3-a.i was unable to rescue m 6 A, but METTL3-a.ii was able to rescue 18.3% of m 6 A. METTL3-b.i could only rescue 8.5% of m 6 A, whereas METTL3-b.ii rescued 24.4% of m 6 A, respectively. Thus, METTL3-a.ii and METTL3-b.ii proteins that are expressed in the exon2 Mettl3 KO mESCs are able to catalyze the formation of m 6 A. Error bars indicate standard error ( n = 3). * = p -value < 0.5, ** = p -value < 0.01, *** = p -value < 0.005, n.s. = not significant. Underlying data can be found in . ( D ) A METTL3-specific inhibitor leads to loss of m 6 A even in exon2 Mettl3 KO mESCs. Exon2 WT and Mettl3 KO mESCs were treated with 30 μM STM2457, a METTL3-specific inhibitor, and m 6 A levels were measured by mass spectrometry after 48 h. STM2457 treatment reduced m 6 A by 82.8% in the WT mESCs. In exon2 Mettl3 KO mESC, m 6 A was reduced by 85.4% in Mettl3 KO mESC-a after STM2457 treatment and by 94.8% in Mettl3 KO mESC-b. Thus, METTL3 is responsible for the remaining m 6 A in the exon2 Mettl3 KO mESCs. Residual m 6 A after STM2457 treatment may reflect incomplete inhibition of METTL3 at 30 μM. Error bars indicate standard error ( n = 3). * = p -value < 0.5, ** = p -value < 0.01, *** = p -value < 0.005, n.s. = not significant. Underlying data can be found in . m 6 A, N 6 -methyladenosine; mESC, mouse embryonic stem cell; NLS, nuclear localization signal; ORF, open reading frame; pAb, polyclonal antibody; WB, western blot; WT, wild-type; ZFD, zinc finger domain.

Article Snippet: Polysomes were isolated from exon2 Mettl3 KO mESCs as follows: cells were lysed in lysis buffer (20 mM Tris-HCL (pH 7.4), 100 mM KCl, 5 mM MgCl 2, 1% Triton-X 100, 100 μg/ml cycloheximide, 2 mM DTT, 1× Halt Protease Inhibitor (Thermo Scientific #78430)) by passing through a 25 G 1 1⁄2 syringe 10 times.

Techniques: Functional Assay, Binding Assay, Transfection, Knock-Out, Western Blot, Mass Spectrometry, Expressing, Inhibition

Journal: PLoS Biology

Article Title: Alternative splicing of METTL3 explains apparently METTL3-independent m 6 A modifications in mRNA

doi: 10.1371/journal.pbio.3001683

Figure Lengend Snippet: ( A ) METTL3 KO U2OS cells have persistent m 6 A. METTL3 KO U2OS cells have been reported to have 60% the levels of m 6 A found in control U2OS cells . We reconfirmed this with mass spectrometry measurements of m 6 A, which showed that METTL3 KO U2OS cells have 75.2% remaining m 6 A compared to WT. Thus, m 6 A levels remain high in METTL3 KO U2OS cells. Error bars indicate standard error ( n = 3). * = p -value < 0.5, ** = p -value < 0.01, *** = p -value < 0.005, n.s. = not significant. Underlying data can be found in . ( B ) METTL3 KO U2OS cells express a novel anti-METTL3-antibody-reactive protein. As m 6 A levels were not completely ablated in the METTL3 KO U2OS cells, we assessed METTL3 protein expression in these cells to confirm if the knockout was effective. We found that WT METTL3 protein was lost in the METTL3 KO U2OS cells, but a larger protein that was reactive to the anti-METTL3 antibody was found in the METTL3 KO U2OS cells. This suggests the METTL3 KO U2OS cells express a novel METTL3 protein that is slightly larger than the WT METTL3. ( C ) Confirmation of a novel METTL3-like protein in METTL3 KO U2OS using a second METTL3 antibody. To confirm that the METTL3-immunoreactive band we saw in METTL3 KO U2OS cells in was METTL3, we used a second anti-METTL3 mAb to confirm the result. The same protein band is immunoreactive to the second anti-METTL3 antibody, thus suggesting that the METTL3 KO U2OS cells express a novel, larger METTL3 protein. ( D ) A METTL3-specific inhibitor leads to loss of m 6 A even in METTL3 KO U2OS cells. WT and METTL3 KO U2OS cells were treated with 30 μM STM2457, and m 6 A levels were measured by mass spectrometry after 48 h. m 6 A was reduced by 89.8% in the WT U2OS cells and 92.1% in the METTL3 KO U2OS cells after STM2457 treatment. It should be noted that 30 μM may not fully inhibit METTL3, so some of the residual m 6 A after STM2457 treatment may still derive from METTL3 isoforms. Thus, a METTL3 isoform is responsible for most of the remaining m 6 A in the METTL3 KO U2OS cells. Error bars indicate standard error ( n = 3). * = p -value < 0.5, ** = p -value < 0.01, *** = p -value < 0.005, n.s. = not significant. Underlying data can be found in . mAb, monoclonal antibody; m 6 A, N 6 -methyladenosine; pAb, polyclonal antibody; WB, western blot; WT, wild-type.

Article Snippet: Polysomes were isolated from exon2 Mettl3 KO mESCs as follows: cells were lysed in lysis buffer (20 mM Tris-HCL (pH 7.4), 100 mM KCl, 5 mM MgCl 2, 1% Triton-X 100, 100 μg/ml cycloheximide, 2 mM DTT, 1× Halt Protease Inhibitor (Thermo Scientific #78430)) by passing through a 25 G 1 1⁄2 syringe 10 times.

Techniques: Control, Mass Spectrometry, Expressing, Knock-Out, Western Blot

Journal: PLoS Biology

Article Title: Alternative splicing of METTL3 explains apparently METTL3-independent m 6 A modifications in mRNA

doi: 10.1371/journal.pbio.3001683

Figure Lengend Snippet: ( A ) Most cell lines are dependent on METTL3 for growth. Mouse studies previously indicated that Mettl3 is an essential gene for early embryonic survival , so we wanted to know which cell lines are dependent on METTL3 . Using the CRISPR gene dependency probability score from the DepMap 21Q4 dataset [ – ], we found that 801 of 1,054 cell lines are dependent on METTL3 (dependency probability score >0.5). Therefore, most cells lines will not survive after METTL3 knockout. The density plot shows the overall distribution of dependency probability scores, while each individual cell line is represented as a dot. U2OS and A549 cell lines (red), where METTL3 has been previously knocked out, are shown here to be dependent on METTL3 and thus should not be viable after METTL3 knockout. Underlying data for this figure was extracted from the DepMap 21Q4 dataset . ( B ) A small subset of cell lines may be m 6 A independent. Although most cell lines are dependent on METTL3 , a small subset of cell lines can survive despite METTL3 knockout. To identify cell lines that we can confidently consider m 6 A-independent, we obtained a list of cell lines whose survival is also independent of other members of the m 6 A writer complex, METTL3 , METTL14 , and WTAP . This approach suggests that 65 cell lines may be able to proliferate in an m 6 A-independent manner . Underlying data for this figure was extracted from the DepMap 21Q4 dataset . ( C ) Mettl3 conditional knockout MEFs do not express METTL3 protein. To determine the amount of m 6 A in mRNA that can be attributed to Mettl3 , we generated a tamoxifen-inducible Mettl3 conditional knockout MEF cell line. We used WB to validate the loss of METTL3. After 5 days of 4-hydroxytamoxifen treatment (500 nM), we observed loss of the WT METTL3 protein. 30 μg per lane. ( D ) Mettl3 conditional knockout MEFs show near-complete loss of m 6 A. We measured m 6 A levels in mRNA derived from tamoxifen-inducible Mettl3 conditional knockout MEFs. Eight days after 4OHT treatment (500 nM), the Mettl3 KO MEFs showed 3.6% remaining m 6 A. Hence, m 6 A is almost completely lost after Mettl3 knockout in MEFs. Error bars indicate standard error ( n = 3). * = p -value < 0.5, ** = p -value < 0.01, *** = p -value < 0.005, n.s. = not significant. Underlying data can be found in . m 6 A, N 6 -methyladenosine; MEF, mouse embryonic fibroblast; pAb, polyclonal antibody; WB, western blot; 4OHT, 4-hydroxytamoxifen.

Article Snippet: Polysomes were isolated from exon2 Mettl3 KO mESCs as follows: cells were lysed in lysis buffer (20 mM Tris-HCL (pH 7.4), 100 mM KCl, 5 mM MgCl 2, 1% Triton-X 100, 100 μg/ml cycloheximide, 2 mM DTT, 1× Halt Protease Inhibitor (Thermo Scientific #78430)) by passing through a 25 G 1 1⁄2 syringe 10 times.

Techniques: CRISPR, Knock-Out, Generated, Derivative Assay, Western Blot

Journal: bioRxiv

Article Title: DOT1L bridges transcription and heterochromatin formation at pericentromeres

doi: 10.1101/2021.10.21.465349

Figure Lengend Snippet: (A) Immunofluorescence staining of single prometaphase nuclei showing H3K79me3 or H3K79me2 (green) and mitotic marker phospho-H3S10 (H3S10P, red). DNA is stained with DAPI (blue). Bottom, schematic of chromosomes at prometaphase showing arrangement of centromeres at the center of the metaphase plate. Scale bar, 2µm. (B) Immunofluorescence staining of single nuclei for H3K79me3 or H3K79me2 (green) and the pericentromeric heterochromatin marker HMGA1 (red). Upper panels, prometaphase; lower panels, interphase. DNA is stained with DAPI (blue). Scale bar, 2µm. (C) Selected gene ontology (GO) terms enriched among genes located near H3K79me2 or K3K79me3 peaks in mESCs. Break in the top 5 bars indicates a discontinuous axis. See Supplementary Table 2 for complete term lists. (D) Representative ChIP-seq tracks for H3K79me2 and H3K79me3 at a locus enriched for both marks (left) and a locus enriched for H3K79me2 only (right) in wild type and Dot1L KO mESCs. Two biological replicates are shown. (E) Fraction of ChIP and input libraries composed of non-uniquely mapping reads for H3K79me2 and H3K79me3 ChIP-seq data. **p<0.01, ***p<0.001, two-tailed Student’s t-test. (F) Heatmap of H3K79me2 and H3K79me3 ChIP-seq enrichment relative to input at selected repetitive element sequences.

Article Snippet: Dot1L KO mESCs were transfected with MSCB-hDot1Lwt plasmid (Addgene #74173) expressing HA-tagged human DOT1L.

Techniques: Immunofluorescence, Staining, Marker, ChIP-sequencing, Two Tailed Test

Journal: bioRxiv

Article Title: DOT1L bridges transcription and heterochromatin formation at pericentromeres

doi: 10.1101/2021.10.21.465349

Figure Lengend Snippet: A, Partial sequence of Dot1L exon 5 showing the sequence deleted in Dot1L KO cells, and the sequences (red and orange lines) and PAM sites (red and orange boxes) for the two guide RNAs used to generate the knockout. B, Western blots showing H3K79 methylation in Dot1L KO cells. GAPDH was used as a loading control. mESCs were grown on feeder cells, which are the likely source of residual bands seen in Dot1L KO cells.

Article Snippet: Dot1L KO mESCs were transfected with MSCB-hDot1Lwt plasmid (Addgene #74173) expressing HA-tagged human DOT1L.

Techniques: Sequencing, Knock-Out, Western Blot, Methylation, Control

Journal: bioRxiv

Article Title: DOT1L bridges transcription and heterochromatin formation at pericentromeres

doi: 10.1101/2021.10.21.465349

Figure Lengend Snippet: (A) Volcano plot of differentially expressed single-copy genes in Dot1L KO mESCs (log2 fold change ≥ 1, adjusted p-value ≤ 0.05). Each point represents one gene. Differentially expressed genes are shown in red. (B) Selected GO terms enriched among significantly upregulated single-copy genes in Dot1L KO mESCs. See Supplementary Table 4 for complete term lists. (C) Differential expression of repeat element classes in Dot1L KO relative to control mESCs. Red dot indicates relative expression of major satellite transcripts within the broader set of annotated satellite sequences. Boxes represent interquartile range (25 th -75 th percentile) of uniquely annotated repeat classes within each broad category; whiskers represent maximum and minimum values. Total number of repeat element annotations included in each class is shown in parentheses. (D) Strip plot showing relative expression of selected specific repeat element annotations in Dot1L KO mESCs compared to control. (E) Quantitative real-time PCR (RT-qPCR) of major satellite transcripts in wild type mESCs, Dot1L KO mESCs, and wild type mESCs treated with DOT1L inhibitor. Bars represent mean of four biological replicates for control and Dot1L KO, and two biological replicates for inhibitor-treated cells. Values were normalized to Gapdh as an internal control. Error bars represent ± standard error of the mean (SEM). **p < 0.001, ***p < 0.0001, two-tailed Student’s t test. (F) ChIP-qPCR for PolII-S2P at selected repeat elements. Bars represent mean of three biological replicates and error bars represent ± SEM. *p < 0.05, two-tailed Student’s t test.

Article Snippet: Dot1L KO mESCs were transfected with MSCB-hDot1Lwt plasmid (Addgene #74173) expressing HA-tagged human DOT1L.

Techniques: Quantitative Proteomics, Control, Expressing, Stripping Membranes, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Two Tailed Test, ChIP-qPCR

Journal: bioRxiv

Article Title: DOT1L bridges transcription and heterochromatin formation at pericentromeres

doi: 10.1101/2021.10.21.465349

Figure Lengend Snippet: A, Gene sets that are transcriptionally downregulated (top) or upregulated (bottom) and marked by H3K79me2, H3K79me3, or both in Dot1L KO mESCs. B, RT-qPCR for selected repeat element transcripts in wild type and Dot1L KO mESCs. Bars represent mean of 3 biological replicates and error bars represent ± SEM. *p<0.05, **p<0.01, ***p<0.001, unpaired Student’s t-test.

Article Snippet: Dot1L KO mESCs were transfected with MSCB-hDot1Lwt plasmid (Addgene #74173) expressing HA-tagged human DOT1L.

Techniques: Quantitative RT-PCR

Journal: bioRxiv

Article Title: DOT1L bridges transcription and heterochromatin formation at pericentromeres

doi: 10.1101/2021.10.21.465349

Figure Lengend Snippet: (A) ChIP-qPCR for HP1β at selected repeat elements in Dot1L KO and wild type mESCs. Bars represent mean of two biological replicates and error bars represent ± SEM. *p < 0.05, two-tailed Student’s t test. (B) Immunofluorescence staining of HP1β (green) in wild type and Dot1L KO mESCs. DNA is stained with DAPI (blue). Z-axis signal is shown on the top and right of each image. Scale bar, 10µm.

Article Snippet: Dot1L KO mESCs were transfected with MSCB-hDot1Lwt plasmid (Addgene #74173) expressing HA-tagged human DOT1L.

Techniques: ChIP-qPCR, Two Tailed Test, Immunofluorescence, Staining

Journal: bioRxiv

Article Title: DOT1L bridges transcription and heterochromatin formation at pericentromeres

doi: 10.1101/2021.10.21.465349

Figure Lengend Snippet: (A) Selected proteins detected by DOT1L IP-MS along with their unique peptide count. See Supplementary Table 5 for complete list of interactors. (B) Selected GO terms enriched among proteins that were co-immunoprecipitated with DOT1L. Terms associated with transcriptional repression are highlighted in blue. See Supplementary Table 6 for complete list of terms. (C) Western blot for candidate heterochromatin-associated interactors following co-immunoprecipitation with DOT1L. mESCs were grown on feeder cells, resulting in faint residual bands in the Dot1L KO lane. (D) Immunofluorescence staining of SMARCA5 (green) and HMGA1 (red) in mESCs, indicating localization of SMARCA5 to heterochromatic regions. Arrowheads indicate an example of SMARCA5 enrichment at PCH. DNA is stained with DAPI (blue). Scale bar, 4µm. (E) Immunofluorescence staining of SMARCA5 (green) and HMGA1 (red) in mouse fibroblasts, indicating localization of SMARCA5 to heterochromatic regions. Arrowheads indicate and example of SMARCA5 enrichment at PCH. DNA is stained with DAPI (blue). Scale bar, 4µm. (F) ChIP-qPCR for H3K79me3 at major satellite sequences in control and Smarca5 knockdown (KD) mESCs. Bars represent mean of two biological replicates. Error bars represent represent ± SEM. (G) RT-qPCR for major satellite transcripts in control and Smarca5 KD mESCs. Data represent transcript levels in three different Smarca5 KD clones that stably express a single shRNA against Smarca5 . Bars represent mean of two biological replicates. Error bars represent ± SEM. *p < 0.05, two-tailed Student’s t test.

Article Snippet: Dot1L KO mESCs were transfected with MSCB-hDot1Lwt plasmid (Addgene #74173) expressing HA-tagged human DOT1L.

Techniques: Protein-Protein interactions, Immunoprecipitation, Western Blot, Immunofluorescence, Staining, ChIP-qPCR, Control, Knockdown, Quantitative RT-PCR, Clone Assay, Stable Transfection, shRNA, Two Tailed Test

Journal: bioRxiv

Article Title: DOT1L bridges transcription and heterochromatin formation at pericentromeres

doi: 10.1101/2021.10.21.465349

Figure Lengend Snippet: (A) Immunofluorescence staining of H3K79me3 (green) and H3S10P (red) in a single nucleus of control and Dot1L KO mESCs. DNA is stained with DAPI (blue). Scale bar, 5 µm. (B) Example metaphase spreads in wild type and Dot1L KO mESCs showing chromosome breaks (arrowheads). (C-E) Quantitation of chromosome defects in Dot1L KO mESCs, including chromosomal breaks and fragments (C), premature centromere separation (D), and chromosome fusions (E). Insets show representative examples of each chromosome defect. Scale bar, 2 µm. N=201 (wild type) or n=445 (KO) chromosomes from n=46 (wild type) or n=65 (KO) individual nuclei in two independent experiments. p-values, Fisher’s Exact test.

Article Snippet: Dot1L KO mESCs were transfected with MSCB-hDot1Lwt plasmid (Addgene #74173) expressing HA-tagged human DOT1L.

Techniques: Immunofluorescence, Staining, Control, Quantitation Assay

Journal: bioRxiv

Article Title: DOT1L bridges transcription and heterochromatin formation at pericentromeres

doi: 10.1101/2021.10.21.465349

Figure Lengend Snippet: (A) Immunofluorescence staining of H3K79me3 (green) and H3K9me3 (red) in wild type embryos during the first 48 hours of preimplantation development. DNA is stained with DAPI (blue). Scale bar, 10 µm (main image) or 4 µm (inset). (B) Immunofluorescence staining of H3K79me3 (green) and H3K9me3 (red) in DOT1L inhibitor-treated embryos at 48 hpf. DNA is stained with DAPI (blue). Scale bar, 10µm (main image) or 4 µm (inset). (C) Quantification of the fraction of fertilized zygotes that progress to a given state at each time point in control (vehicle treated) and inhibitor-treated embryos. Numbers of embryos that successfully progressed to a given stage were counted at each time point and the fraction for each is shown. Points represent the mean of 4-5 independent experiments. **q < 0.01, ***q < 0.001; false discovery rate (FDR) q-values calculated by unpaired t-test with two-state step-up correction for multiple comparisons. (D) Quantification of cell number per embryo at indicated time points in control (DMSO treated) and inhibitor-treated embryos. Numbers of nuclei per embryo were counted at each time point in three independent experiments. Bars represent mean and standard deviation. **q < 0.01; false discovery rate (FDR) q-values calculated by unpaired t-test with two-state step-up correction for multiple comparisons. n.s., not significant at a threshold of q < 0.05.

Article Snippet: Dot1L KO mESCs were transfected with MSCB-hDot1Lwt plasmid (Addgene #74173) expressing HA-tagged human DOT1L.

Techniques: Immunofluorescence, Staining, Control, Standard Deviation

Journal: bioRxiv

Article Title: DOT1L bridges transcription and heterochromatin formation at pericentromeres

doi: 10.1101/2021.10.21.465349

Figure Lengend Snippet: (A) Volcano plot showing differentially expressed single-copy genes in DOT1L inhibitor-treated vs control embryos at 56hpf (8 cell stage). Each dot signifies one gene. Differentially expressed genes (adjusted p-value ≤ 0.05) are shown in red. (B) Selected enriched GO terms among significantly upregulated and downregulated single-copy genes in inhibitor-treated vs vehicle-treated embryos. (C) Volcano plot of annotated repeat elements in DOT1L inhibitor-treated vs vehicle-treated eight-cell embryos (56 hpf). Each dot signifies one annotated repetitive element category as indicated by RepeatMasker (Smit et al). Differentially expressed repetitive elements (adjusted p-value ≤ 0.05) are shown in red. The major satellite element is indicated. (D) Strip plot showing log2 fold change of selected repeat elements in eight-cell embryos as shown in C. (E) Model for DOT1L function at PCH and euchromatic single-copy genes. DOT1L coordinates with SMARCA5, CHD4, and HMGA1 for its recruitment to PCH to promote major satellite transcription, but interacts with the DotCom complex, including AF9, AF10, and ELL, at transcribed single copy genes.

Article Snippet: Dot1L KO mESCs were transfected with MSCB-hDot1Lwt plasmid (Addgene #74173) expressing HA-tagged human DOT1L.

Techniques: Control, Stripping Membranes

Journal: eLife

Article Title: SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B

doi: 10.7554/elife.67452

Figure Lengend Snippet: Figure 1. Deletion of SIRT1 in mESCs results in a dramatic accumulation of sphingomyelin. (A) Metabolomic analysis reveals a massive accumulation of sphingolipids in SIRT1 KO mESCs. WT and SIRT1 KO mESCs were cultured in a complete mESC maintenance medium (M10) and metabolites were analyzed by metabolomics as described in Materials and methods. The networks of significantly changed metabolites in lipid metabolism were analyzed by Cytoscape 2.8.3. Metabolites increased in SIRT1 KO mESCs were labeled red (p<0.05) or pink (0.05 < p < 0.10), metabolites decreased in SIRT1 KO mESCs were labeled blue (p<0.05) or light blue (0.05 < p < 0.10). Metabolite node size is proportional to the fold change in KO vs WT (n = 5 biological replicates). (B) The relative abundance of different metabolites mapped into sphingolipid metabolism pathways. Metabolites in sphingolipid metabolism in WT and SIRT1 KO mESCs were analyzed as in (A) and the relative abundance of metabolites involved in sphingolipid metabolism was displayed by the heat map (n = 5 biological replicates). (C–D) SIRT1 KO mESCs have increased levels of BODIPY FL-labeled sphingomyelin. WT and SIRT1 KO mESCs cultured in ESGRO medium were labeled with BODIPY FL-labeled sphingomyelin for 30 min at 4˚C then chased at 37˚C for 30 min. The intensity of BODIPY FL-labeled sphingomyelin in cells was analyzed by (C) confocal fluorescence imaging and by (D) quantitative FACS (n = 3 biological replicates, ***p<0.001). Scale bars: 20 mm. (E) SIRT1 KO mESCs have increased levels of endogenous sphingomyelin. WT and SIRT1 KO mESCs cultured in ESGRO medium were extracted and total levels of endogenous sphingomyelin were determined in extracts by an enzyme-coupled colorimetric assay as described in Materials and methods (n = 3 biological replicates, *p<0.05). (F–H) Deletion of SIRT1 in E14 mESCs leads to accumulation of sphingomyelin. (F) SIRT1 was deleted in E14 mESC line using CRISPR/cas9 mediated gene editing technology and (G) relative levels of BODIPY FL-labeled sphingomyelins were imaged and (H) measured (n = 2 independent clones with three biological replicates for each clone, ***p<0.001). GC-01, pCRISPR-CG01 vector. Scale bars: 20 mm. The online version of this article includes the following source data and figure supplement(s) for figure 1:

Article Snippet: Three independent WT and SIRT1 KO E14 mESCs were used for the experiments to minimize the potential off-target effects of each individual line. mESCs stably transfected with pEF1a-FB-dCas9-puro (Addgene #100547) and pEF1a-BirA-V5-neo (Addgene #100548) vectors (dCas9 mESCs) are described previously (Liu et al., 2017).

Techniques: Cell Culture, Labeling, Fluorescence, Imaging, Colorimetric Assay, CRISPR, Clone Assay, Plasmid Preparation

Journal: eLife

Article Title: SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B

doi: 10.7554/elife.67452

Figure Lengend Snippet: Figure 2. SIRT1-deficient mESCs have reduced expression of SMPDL3B and sphingomyelin degradation. (A) SIRT1 KO mESCs have reduced mRNA levels of Smpdl3b. WT and SIRT1 KO mESCs were cultured in either ESGRO medium or M10 medium. The mRNA levels of indicated enzymes involved in sphingomyelin synthesis (Sgms) and degradation (Smpd) were analyzed by qPCR (n = 3 biological replicates, *p<0.05, **p<0.01). (B–C) SIRT1 KO mESCs have reduced protein levels of SMPDL3B. The protein levels of SMPDL3B were analyzed by (B) immunoblotting and (C) immuno-fluorescence staining. Scale bars: 20 mm. (D) SIRT1 KO mESCs have reduced degradation of sphingomyelin. WT and SIRT1 KO mESCs were preloaded with BODIPY FL-C5 sphingomyelin for 30 min at 4˚C, then incubated with BODIPY FL-C5 sphingomyelin-free medium at 37˚C. The dynamic of BODIPY FL- sphingomyelin was monitored for additional 12 hr at 37˚C. WT and SIRT1 KO mESC clones that have comparable preloaded levels of BODIPY FL-C5 sphingomyelin were shown. Scale bars: 20 mm. The online version of this article includes the following source data and figure supplement(s) for figure 2:

Article Snippet: Three independent WT and SIRT1 KO E14 mESCs were used for the experiments to minimize the potential off-target effects of each individual line. mESCs stably transfected with pEF1a-FB-dCas9-puro (Addgene #100547) and pEF1a-BirA-V5-neo (Addgene #100548) vectors (dCas9 mESCs) are described previously (Liu et al., 2017).

Techniques: Expressing, Cell Culture, Western Blot, Fluorescence, Staining, Incubation, Clone Assay

Journal: eLife

Article Title: SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B

doi: 10.7554/elife.67452

Figure Lengend Snippet: Figure 3. SMPDL3B directly controls the sphingomyelin contents in mESCs. (A) Overexpression of SMPDL3B in mESCs. WT and SIRT1 KO mESCs were infected with lentiviral particles containing empty vector (V) or a construct expressing SMPDL3B. The expression of SMPDL3B was analyzed by immuno- blotting. (B–C) Overexpression of SMPDL3B reduces sphingomyelin levels in mESCs cultured in M10 medium. The cellular levels of sphingomyelin in WT and SIRT1 KO mESCs with or without overexpression of SMPDL3B were analyzed by (B) BODIPY FL-sphingomyelin confocal imaging, and (C) FACS assay (n = 3 biological replicates, *p<0.05, **p<0.01). Scale bars in (B): 20 mm. L3B in (C): SMPDL3B. (D–F) Overexpression of WT but not a catalytic inactive mutant SMPDL3B reduces sphingomyelin levels in mESCs cultured in in M10 medium. WT and SIRT1 KO mESCs transfected with an empty vector (V), a construct expressing WT SMPDL3B protein (SMPDL3B WT), or a construct expressing a catalytic inactive mutant SMPDL3B protein (SMPL3B H135A). The cellular levels of sphingomyelin in these transfected cells were analyzed by (D) BODIPY FL-sphingomyelin staining, (E) BODIPY FL- sphingomyelin FACS assay, or (F) an enzyme-coupled colorimetric assay for endogenous sphingomyelin. (n = 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001). (G) Stable knockdown of the expression of SMPDL3B in mESCs. WT and SIRT1 KO mESCs were infected with lentiviral particles containing empty vector (V) or shRNA constructs for SMPDL3B (B11, B12, C1). The expression of SMPDL3B were analyzed by immuno-blotting. shL3B: shRNAs against SMPDL3B. (H–J) Knocking down SMPDL3B increases sphingomyelin levels in WT mESCs but not significantly further in SIRT1 KO mESCs in ESGRO medium. The cellular levels of sphingomyelin in WT and SIRT1 KO mESCs with or without stable knockdown of SMPDL3B were analyzed by (H) BODIPY FL-sphingomyelin confocal imaging, (I) BODIPY FL-sphingomyelin FACS assay, or (J) an enzyme-coupled colorimetric assay for endogenous sphingomyelin (n = 3 biological replicates, **p<0.01, ***p<0.001). Scale bars: 20 mm. The online version of this article includes the following source data and figure supplement(s) for figure 3:

Article Snippet: Three independent WT and SIRT1 KO E14 mESCs were used for the experiments to minimize the potential off-target effects of each individual line. mESCs stably transfected with pEF1a-FB-dCas9-puro (Addgene #100547) and pEF1a-BirA-V5-neo (Addgene #100548) vectors (dCas9 mESCs) are described previously (Liu et al., 2017).

Techniques: Over Expression, Infection, Plasmid Preparation, Construct, Expressing, Cell Culture, Imaging, Mutagenesis, Transfection, Staining, Colorimetric Assay, Knockdown, shRNA

Journal: eLife

Article Title: SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B

doi: 10.7554/elife.67452

Figure Lengend Snippet: Figure 4. Expression of WT but not catalytically inactive SIRT1 partially rescues the sphingomyelin defect in SIRT1 KO mESCs. (A–B) SIRT1 protein levels in indicated mESCs. WT and SIRT1 KO mESCs were infected with lentiviral particles containing empty vector (PLenti-III-EF1a) or constructs expressing WT or a catalytically inactive mutant SIRT1 (H355Y, HY). The expression of SIRT1 was analyzed by either (A) immunoblotting or (B) immunofluorescence staining. Bars in B: 20 mm. (C–D) Expression of the HY mutant SIRT1 represses the expression of Smpdl3b in WT mESCs, whereas expression of WT but not the HY mutant SIRT1 increases the expression of Smpdl3b in SIRT1 KO mESCs. The expression of SMPDL3B was analyzed by either (C) qPCR or (D) immunoblotting. (n = 3 biological replicates, ***p<0.001). (E–F) Expression of WT but not HY mutant SIRT1 significantly reduces the sphingomyelin levels in both WT and SIRT1 KO mESCs. Indicated WT and SIRT1 KO mESCs cultured in ESGRO medium were labeled with BODIPY FL-labeled sphingomyelin for 30 min at 4 ˚C then incubated at 37˚C for 30 min. The intensity of BODIPY FL-labeled sphingomyelin in cells were analyzed by (E) confocal fluorescence imaging and by (F) quantitative FACS (n = 3 biological replicates, ***p<0.001). Bars in E: 20 mm. The online version of this article includes the following source data for figure 4:

Article Snippet: Three independent WT and SIRT1 KO E14 mESCs were used for the experiments to minimize the potential off-target effects of each individual line. mESCs stably transfected with pEF1a-FB-dCas9-puro (Addgene #100547) and pEF1a-BirA-V5-neo (Addgene #100548) vectors (dCas9 mESCs) are described previously (Liu et al., 2017).

Techniques: Expressing, Infection, Plasmid Preparation, Construct, Mutagenesis, Western Blot, Immunofluorescence, Staining, Cell Culture, Labeling, Incubation, Fluorescence, Imaging

Journal: eLife

Article Title: SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B

doi: 10.7554/elife.67452

Figure Lengend Snippet: Figure 5. SIRT1 promotes the transcription of Smpdl3b through c-Myc in mESCs. (A) SIRT1 KO mESCs have reduced transcription of Smpdl3b. WT and SIRT1 KO mESCs cultured in ESGRO medium were crosslinked and subjected for ChIP-qPCR profiling of PolII, c-Myc, EZH2, and indicated chromatin activation or repression marks near the TSS region of Smpdl3b gene (n = 4 biological replicates, *p<0.05, **p<0.01, ***p<0.001). (B) Association scores of potential transcription factors (TFs) near the TSS of Smpdl3b gene. The association scores of indicated TFs were obtained from a published dataset (Evans et al., 2014). A higher score is suggestive of a higher chance of Smpdl3b gene being targeted by the potential TF. (C) A guide RNA (gRNA) targeting the +528 locus at the TSS region of Smpdl3b gene rescues the expression of this gene. sgRNAs targeting indicated loci near the TSS region of Smpdl3b gene were transfected into WT and SIRT1 KO mESCs stably expressing a dox-inducible dCas9 and BirA-V5 (dCas9 mESCs). The mRNA levels of Smpdl3b were analyzed by qPCR (n = 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001). (D) Inhibition of c-Myc activity reduces the expression of Smpdl3b gene in mESCs. WT and SIRT1 KO mESCs were treated with DMSO or 10 mM 10058-F4 for 48 hr. The mRNA levels of Smpdl3b were analyzed by qPCR (n = 3 biological replicates, *p<0.05, **p<0.01, ***p<0.001). (E) Knocking down c-Myc significantly reduces the expression of Smpdl3b gene in mESCs. WT and SIRT1 KO mESCs were transfected with siRNAs against c-Myc for 48 hr. The mRNA levels of c-Myc and Smpdl3b were analyzed by qPCR (n = 3 biological replicates, *p<0.05, **p<0.01). (F) Overexpression of the KR mutant of c-Myc partially reduces the expression of Smpdl3b gene in SIRT1 KO mESCs. The mRNA levels of Smpdl3b in indicated mESCs were analyzed by qPCR (n = 6 biological replicates, **p<0.01, ***p<0.001). (G) Mutation of the c-Myc binding E-box element on the promoter of Smpdl3b gene abolishes the expression of Smpdl3b luciferase Figure 5 continued on next page

Article Snippet: Three independent WT and SIRT1 KO E14 mESCs were used for the experiments to minimize the potential off-target effects of each individual line. mESCs stably transfected with pEF1a-FB-dCas9-puro (Addgene #100547) and pEF1a-BirA-V5-neo (Addgene #100548) vectors (dCas9 mESCs) are described previously (Liu et al., 2017).

Techniques: Cell Culture, ChIP-qPCR, Activation Assay, Expressing, Transfection, Stable Transfection, Inhibition, Activity Assay, Over Expression, Mutagenesis, Binding Assay, Luciferase

Journal: eLife

Article Title: SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B

doi: 10.7554/elife.67452

Figure Lengend Snippet: Figure 6. Sphingomyelin accumulation increases membrane fluidity and induces expression of Nestin in SIRT1 KO mESCs. (A) SIRT1 KO mESCs have an increased membrane fluidity. WT and SIRT1 KO mESCs cultured in ESGRO medium were preincubated with or without 2.5 mM MbCD for 1 hr, then stained with 5 mM di-4-ANEPPDHQ for at least 30 min. The relative ordered fraction in each group was analyzed as described in Materials and methods (n = 30 clones/group, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Bars: 10 mm. (B–C) Exogeneous sphingomyelin treatment increases Nestin but not pluripotency markers in mESCs. WT and SIRT1 KO mESCs were treated with indicated concentrations of sphingomyelin (SM) in ESGRO medium for 48 hr. (B) The intensity of AP was analyzed as described in Materials and methods. Bars: 100 mm. (C) The protein abundance of pluripotency marker OCT3/ 4, Nanog and neuroepithelial stem cell marker Nestin in WT and Sirt1 KO mESCs were determined by immunoblotting. (D) Overexpression of WT but not a catalytic inactive mutant SMPDL3B reduces the expression of Nestin in SIRT1 KO mESCs. WT and SIRT1 KO mESCs transfected with an empty vector (V), a construct expressing WT SMPDL3B protein (SMPDL3B WT), or a construct expressing a catalytic inactive mutant SMPDL3B protein (SMPL3B H135A) were stained for SMPDL3B and Nestin. Scale bars: 20 mm. The online version of this article includes the following source data and figure supplement(s) for figure 6:

Article Snippet: Three independent WT and SIRT1 KO E14 mESCs were used for the experiments to minimize the potential off-target effects of each individual line. mESCs stably transfected with pEF1a-FB-dCas9-puro (Addgene #100547) and pEF1a-BirA-V5-neo (Addgene #100548) vectors (dCas9 mESCs) are described previously (Liu et al., 2017).

Techniques: Membrane, Expressing, Cell Culture, Staining, Clone Assay, Quantitative Proteomics, Marker, Western Blot, Over Expression, Mutagenesis, Transfection, Plasmid Preparation, Construct

Journal: eLife

Article Title: SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B

doi: 10.7554/elife.67452

Figure Lengend Snippet: Figure 7. SIRT1 KO mESCs have an impaired neural differentiation in vitro. (A) A diagram of the in vitro neural differentiation system. (B) SIRT1 KO E14 mESCs are less responsive to in vitro neural differentiation than WT mESCs. The expression of indicated genes were analyzed by qPCR during 4 weeks of in vitro neural differentiation. Please note that deletion of SIRT1 resulted in reduction in both repression of pluripotent factors and induction of markers for neural progenitors/stem cells and neurons (n = 3 biological replicates, *p<0.05, **p<0.01). (C) SIRT1 KO E14 mESCs have reduced expression of neural differentiation markers and disordered neuronal morphology. WT and SIRT1 KO E14 mESCs after 4 weeks of in vitro neural differentiation were stained for a neural progenitor marker SOX1 (left panels) and neuronal markers beta III tubulin (TUBB3, middle panels) and TH (right panels). Scale bars: 20 mm. (D) SIRT1 KO mESCs have reduced expression of TUBB3 and mature neuronal morphology. WT and SIRT1 KO mESCs after 4 weeks of in vitro neural differentiation were stained for TUBB3. Scale bars: 50 mm. The online version of this article includes the following source data for figure 7:

Article Snippet: Three independent WT and SIRT1 KO E14 mESCs were used for the experiments to minimize the potential off-target effects of each individual line. mESCs stably transfected with pEF1a-FB-dCas9-puro (Addgene #100547) and pEF1a-BirA-V5-neo (Addgene #100548) vectors (dCas9 mESCs) are described previously (Liu et al., 2017).

Techniques: In Vitro, Expressing, Staining, Marker

Journal: eLife

Article Title: SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B

doi: 10.7554/elife.67452

Figure Lengend Snippet: Figure 8. Reduced expression of SMPDL3B is partially responsible for impaired in vitro neural differentiation in SIRT1 KO mESCs. (A) Overexpression of SMPDL3B partially rescues gross neuronal morphology in in vitro differentiated SIRT1 KO mESCs. WT and SIRT1 KO mESCs stably infected with lentiviral particles containing empty vector (V) or constructs expressing SMPDL3B protein were subjected to 4 weeks of in vitro neural differentiation. The cell morphology was analyzed using regular light microscopy fixed with ZEISS AxioCamHR camera. Scale bars: 20 mm. (B) Overexpression of SMPDL3B partially rescues neuronal morphology in in vitro differentiated SIRT1 KO cells. WT and SIRT1 KO mESCs expressing vector (V) or SMPDL3B were differentiated for 4 weeks or 6 weeks. Six weeks of differentiation is for a better morphological analysis. The expression of TUBB3 and neuronal morphology were analyzed by immunofluorescence staining. Scale bars: 20 mm. (C) Overexpression of SMPDL3B partially increased the fraction of differentiated cells in in vitro differentiated SIRT1 KO cells. WT and SIRT1 KO mESCs expressing vector (V) or SMPDL3B were differentiated as in (A). The fraction of differentiated cells positive of indicated neural markers were quantified by FACS (n = 3 biological replicates, **p<0.01, ***p<0.001). (D) Overexpression of SMPDL3B partially rescues the expression of neural markers in in vitro differentiated SIRT1 KO cells. WT and SIRT1 KO mESCs expressing vector (V) or SMPDL3B were differentiated as in (A). The expression of indicated neural markers were analyzed by immunofluorescence staining. Scale bars: 20 mm. (E) Overexpression of SMPDL3B partially rescues the expression of neural progenitor markers in in vitro differentiated SIRT1 KO cells. WT and SIRT1 KO mESCs expressing vector (V) or SMPDL3B were differentiated as in (A). The expression of SOX2 and SOX3 were analyzed by qPCR (n = 3 biological replicates, *p<0.05, **p<0.01). (F) Knocking down SMPDL3B in WT mESCs impairs neural differentiation in vitro. WT and SIRT1 KO mESCs with or without stable knockdown of SMPDL3B were in vitro differentiated into neurons for 4 weeks. The expression of neural markers Tau and NEFH were analyzed by immunofluorescence staining. Scale bars: 50 mm. (G) WT but not a catalytic inactive SIRT1 rescues neural differentiation in vitro. WT and SIRT1 KO mESCs expressing vector (V), WT SIRT1, or a mutant SIRT1 lacking catalytic activity (HY) were in vitro differentiated into neurons for 4 weeks. The expression of neural markers SOX1 and Nestin were analyzed by immunofluorescence staining. Scale bars: 50 mm. The online version of this article includes the following source data for figure 8:

Article Snippet: Three independent WT and SIRT1 KO E14 mESCs were used for the experiments to minimize the potential off-target effects of each individual line. mESCs stably transfected with pEF1a-FB-dCas9-puro (Addgene #100547) and pEF1a-BirA-V5-neo (Addgene #100548) vectors (dCas9 mESCs) are described previously (Liu et al., 2017).

Techniques: Expressing, In Vitro, Over Expression, Stable Transfection, Infection, Plasmid Preparation, Construct, Light Microscopy, Immunofluorescence, Staining, Knockdown, Mutagenesis, Activity Assay